For your homologous traits provide the following information:
a. Briefly describe (not just identify) the two different species that possess the homologous trait.
-The two species that possess the homologous trait are: The giraffe and a human; while they both contain several similar structures, I am going to focus on the fact that, like other mammals, they both have seven cervical vertebrae.
b. Describe the homologous trait of each species, focusing on the differences in structure and
function of the trait. Why do these homologous traits exhibit differences between the two
species? Make sure your explanation is clear and complete.
-While both humans and giraffes have seven cervical vertebrae with a nuchal ligament and both species use their necks to move their heads as needed, the giraffe's bones are significantly longer, (approx 1 ft long) and are bound together with ball-and-sock joints, thus giving them more flexibility. Male giraffes also use their necks during mating season to so called "go neck to neck" for females.
c. Who was (generally, not specifically) the common ancestor of these two species and how do
you know that ancestor possessed this homologous trait?
-Both giraffes and humans are placental mammals and and their common ancestor (for all placental mammals) is what is referred to as a tiny, furry-tailed creature that evolved after dinosaurs. Also described as a tree climbing, insect eating mammals.
d. Provide an image of each species in this comparison.
-
For your analogous traits provide the following information:
a. Briefly describe the two different species that possess the analogous trait.
-Two species that possess the analogous trait are snakes of North America (e.g. rattle snake) and snakes in Australia (death adder). Snakes on both continents are ambush predators, stout bodied and have the ability to camouflage themselves; however they are dramatically different in diet.
b. Describe the analogous trait of each species, focusing on the similarities in structure and
function of the trait. Clearly explain why these analogous traits exhibit similarities between
the two species.
-The physical similarities of those snakes are thought to be due to evolutionary advantages. Snakes on both continents are slender, fast moving, burrowing snakes with similar body forms and yet they evolved independently of each other in response to convergence. Their similar body types evolved to help improve capturing prey. These snakes are dramatically different in what they eat. (e.g. most small snakes in North America eat invertebrates such as spiders, scorpions, slugs and centipedes and in Australia, those snakes tend to eat lizards and other snakes.)
c. All pairs of organisms share some common ancestor if you go back far enough in time. Could
the common ancestor of these two species have possessed this analogous trait? How do we
know these traits are analogous and not genetically related from common descent?
North America is home to several groups of snakes, however only the elapids colonized in Australia approximately 12 million years ago. Elapids have hollow and fixed fangs that allow injecting venom and are now found worldwide (e.g. king cobras, coral snakes, mambas and kraits). Evolution played a role over a million years ago for Australia's elapids to diversify and specialize through adaptive radiation. Over time, these Australian snakes took on most of the body forms of those found in North America.
d. Provide an image of each species in this comparison.
Thursday, February 22, 2018
Wednesday, February 14, 2018
Week 2 – Protein Synthesis: Blog Post
Here is my DNA Strand: (Enjoy!)
CGGCTACACCTAGTGGGATCTAAGTCTGAATACTCCGAACGTCTCCATCGTTA
CGGCTACACCTAGTGGGATCTAAGTCTGAATACTCCGAACGTCTCCATCGTTA
Thursday, February 8, 2018
Historical Influences on Darwin
I think it is safe to say that most everyone has heard the name Charles Darwin and his theory that goes along with his name; the theory of evolution by natural selection. What some of you may not know is that he was heavily inspired by the works of an English economist by the name of Thomas Malthus.
Malthus had written a book titled, "An Essay on the Principle of Population" which held the belief that growing populations would defeat resources needed for survival. This theory led him to advocate for limiting resources by arguing that if resources were limited than that would help to impede population growth. As you can see in the following article https://www.allaboutscience.org/thomas-malthus-faq.htm, Malthus was very clear in his intentions and believed in God's had a plan to "stop populations from exploding" and that without limiting our resources, our world would "quickly become overcrowded".
While Malthus argued that populations would defeat the amount of resources needed for survival, Darwin saw this as a means to further his theory of evolution by expanding upon those ideals and stating that population growth and limiting of resources could lead to competition, (those who were more equipped to withstand limitations would survive), which was the essence of natural selection. Who gets better access to these limited resources? Only the strong survive. By Malthus's focusing limiting resources, he inadvertently inspired Darwin and even though Malthus did not seek to become such an inspiration, (as he was not interested in how species were evolving and changing), his writings provided a way for Darwin to "refine" the idea of natural selection.
I believe that there is a chance that Darwin could have developed his theory of natural selection without the help of Malthus' book; however, I do not believe it would the theory we have come to know today. Natural selection means what it does today because of Darwin's introduction to Malthus' writings, specifically that "population size is always limited by the amount of available food and water" and that being the cause for a constant struggle to exist. Darwin himself attributes his development of natural selection to his findings in Malthus' essay and stated the following, "it at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The result of this would be the formation of a new species" (F. Darwin, 1950, pp 53-54).
In order for Darwin to make his findings public it would've meant he was directly challenging the christian belief that that "all life on earth was created by God", which would have most likely meant a certain death by fire. It wasn't until new world discoveries were being made and mathematicians and scientists made advances that helped to pave the way to introducing new theories.
Malthus had written a book titled, "An Essay on the Principle of Population" which held the belief that growing populations would defeat resources needed for survival. This theory led him to advocate for limiting resources by arguing that if resources were limited than that would help to impede population growth. As you can see in the following article https://www.allaboutscience.org/thomas-malthus-faq.htm, Malthus was very clear in his intentions and believed in God's had a plan to "stop populations from exploding" and that without limiting our resources, our world would "quickly become overcrowded".
While Malthus argued that populations would defeat the amount of resources needed for survival, Darwin saw this as a means to further his theory of evolution by expanding upon those ideals and stating that population growth and limiting of resources could lead to competition, (those who were more equipped to withstand limitations would survive), which was the essence of natural selection. Who gets better access to these limited resources? Only the strong survive. By Malthus's focusing limiting resources, he inadvertently inspired Darwin and even though Malthus did not seek to become such an inspiration, (as he was not interested in how species were evolving and changing), his writings provided a way for Darwin to "refine" the idea of natural selection.
I believe that there is a chance that Darwin could have developed his theory of natural selection without the help of Malthus' book; however, I do not believe it would the theory we have come to know today. Natural selection means what it does today because of Darwin's introduction to Malthus' writings, specifically that "population size is always limited by the amount of available food and water" and that being the cause for a constant struggle to exist. Darwin himself attributes his development of natural selection to his findings in Malthus' essay and stated the following, "it at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The result of this would be the formation of a new species" (F. Darwin, 1950, pp 53-54).
In order for Darwin to make his findings public it would've meant he was directly challenging the christian belief that that "all life on earth was created by God", which would have most likely meant a certain death by fire. It wasn't until new world discoveries were being made and mathematicians and scientists made advances that helped to pave the way to introducing new theories.
Saturday, February 3, 2018
If you were stranded on a desert island what two items you would take with you and why?
My list of necessities to be stranded on a desert island with would include a machete, alcohol, matches, a tent for shelter, sunscreen, bananas and peanut butter and a water filter/purifier. If I had to choose only two of the aforementioned items to be stranded with, than I would choose a water filter/purifier and a machete.
I would choose the water filter to ensure safe hydration and the machete to cut down food growing on trees, to cut down vines, wood and leaves to build a shelter and raft to sail off the island and lastly to help create a spark to build a fire to keep warm and keep any potential predators away. In addition to the water filter/purifier keeping me safely hydrated while stranded, it would continue to do so while heading back to civilization on my makeshift raft.
I would choose the water filter to ensure safe hydration and the machete to cut down food growing on trees, to cut down vines, wood and leaves to build a shelter and raft to sail off the island and lastly to help create a spark to build a fire to keep warm and keep any potential predators away. In addition to the water filter/purifier keeping me safely hydrated while stranded, it would continue to do so while heading back to civilization on my makeshift raft.
Subscribe to:
Posts (Atom)
Human Variation & Race
Cold; An Environmental Stress Long term responses to the cold can vary and long term exposure can not only be dangerous for humans, it ca...
-
Being that we are humans, born in the 20th century (I may have just aged myself a bit there) and have been exposed to language our entire l...
-
Cold; An Environmental Stress Long term responses to the cold can vary and long term exposure can not only be dangerous for humans, it ca...
-
The Piltdown Hoax was an impactful, game changing 40-year hoax that took place in the small village of Piltdown, East Sussex (England) in 19...



