Human Variation & Race

Cold; An Environmental Stress

Long term responses to the cold can vary and long term exposure can not only be dangerous for humans, it can be fatal without adequate adaptation. An example of how too much exposure can negatively impact the survival of humans by disturbing homeostasis is when an individual develops Hypothermia; a life threatening drop of core body temperature to subnormal levels. Normally temperatures in humans are around 98.7 degrees (F) and while there are several factors, (e.g. metabolism, hormone levels, physical activity or depending on the time of day) that can cause temperatures to rise or decrease by a degree or so, hypothermia occurs when the core body temperature drops to 94 degrees (F). If adequate adaptation has not occurred the body temperature can continue to drop and failing to stay above 85 degrees (F) will cause the hypothalamus to fail, which will then in turn cause rapid cooling of the body. Likely resulting in death.

Short Term Adaptation

Our bodies have ways of rapidly responding to cold, and one way that we adapt in the short term is by shivering. Shivering is an involuntary response where we shake slightly and uncontrollably thus increasing internal heat production by generating body and muscle heat.

Facultative

Another way our bodies respond to cold is by way of a facultative response called Vasoconstriction. Vasoconstriction is a more energy efficient condition that rather than producing heat to combat the cold, it helps us to minimize heat loss. The process involves the narrowing of our blood vessels near the skins surface which preserves our core body heat by reducing peripheral blood flow. Provided that temperatures do not drop to the level of hypothermia, the skin will remain cool, which will in turn prevent heat loss at the body surface.

Developmental
Two significant developmental factors that effect how we physiologically respond to the cold were addressed by a 19th Century naturalist named Carl Bergmann; aptly named Bergmann's Rule. According to Bergmann's Rule body size and shape are the defining factors in combatting the cold. For example, in animals, those that had greater mass and bulk to their make up were found to be in

colder climates. Larger body masses = more body heat being produced; the more cells they have resulting from a greater amount of heat. Larger animals tend to have smaller surface areas, which means there is less of an area to lose internal heat. An example of this in the animal kingdom is a Polar bear. Polar bears with their heavy fur and fat insulation along with their relatively smaller surface areas can retain their body heat.

Cultural
While there are less productive ways to culturally respond to cold, (e.g. drinking alcohol), I am going to focus on the following fundamental idea: insulated housing. When accessible, we humans have the ability to shelter ourselves in our homes, perhaps curled up in a blanket by a fire to keep warm. Cuddling up with loved ones can also help to minimize heat loss.

I believe the benefits to studying human variation from this perspective across environmental clines are that we are able to learn how our bodies can respond physiologically, whether it's by retaining heat or increasing heat production.  Information obtained while studying this variation can he helpful in the future by knowing what factors will be needed when traveling to other destinations where the elements are far colder than what we're used to. Because we have now studied this type of variation and adaptations to this variation, we are now armed with the knowledge of what symptoms to look out for and to potentially be able to recognize dangerous developments or responses that might occur when exposed to colder climates.   For example, I now know that when I am shivering it's my body's way of trying to help me by trying to produce body and muscle heat and that it isn't necessarily a red flag behavior.

Race as a classification alone should not be used to categorize humans, as we are not distinguished by characteristics or traits from one race to the next.  Race was a concept that evolved to give reason to be able to deny rights and freedoms to some, while empowering others. Our genetic traits are inherited independently of each other and all humans have all evolved from our earlier ancestors. From a variation study point of view, race has no biological validity. The study of environmental influences on adaptations is a better way to understanding human variation because we can study the genetic make up of an individual as well as the environmental factors that may play a role in the variation type. Learning how those who came before us adapted or how those in colder climates adapt can lend to our being more prepared in the future. Studying how our bodies react to the cold in conjunction with our developmental and cultural responses is what gives us insight to human variation and our race has no bearing on those responses.

Language Blog Post

Being that we are humans, born in the 20th century (I may have just aged myself a bit there) and have been exposed to language our entire lives it was a bit difficult at first to hold a conversation without any words. I imagined if we had been living during a time before language existed thought about what that would look like. If we were never exposed to this thing we call language and had to figure it out from the beginning, would it have been so "difficult"?  

In the 1st experiment where I was only able to use hand signs, body language and non-verbal vocalization I was actually quite successful in getting my points across.  I was able to easily point to what I wanted and nod my head in agreement. I am currently working toward my A.A. in ASL interpreting so while I did NOT use any ASL to communicate, it was simple for me to use various hand signs and facial expressions to communicate. One crucial thing to mention here is that when learning about language you learn that there is so much entailed in communicating. In fact, only 6% of language is actually communicated with our actual words, and 55% is communicated with facial expressions, gestures and body language (body language is KEY). So it was easy for me to ask my husband how he was doing by simply pointing at him, tilting my head to the side, while slightly nodding, with a concerned expression on my face. And when he would respond with, "what's wrong"? I would nod my head yes as if to confirm that was what I was asking him. My husband, did not really alter his communication, except for a couple times he would point at something rather than saying the words as if he was instinctively using the same methods as me.  It was easier than it would have been had I not explained to him what I was trying to accomplish and why.  

If my husband and I represented two different cultures where one of us used spoken language and one of us did not I feel like neither one of us would be at an advantage. I say this because, like previously stated, language is more than just "words"; it's more than what's actually being said. When it comes to complex ideas there might be a bit of a struggle; however, I strongly believe that over time we would develop our own language that worked for the both of us where ideas, complex or not, would be communicated easily.  It's difficult for me to differentiate between cultures who do and do not use "symbolic language" because I find that all cultures have a method of communication and while those methods may not make sense to us, they are their way of life. Our attitude toward varying cultures who do not use language the way we do is misunderstood. There are processing disorders and spectrum disorders where verbal language may take longer to process or may not exist at all. The Deaf Community is often times discriminated against simply because they cannot hear.  It's as if their inability to hear automatically makes them incapable of other things. This might sound like a cliche; however, knowledge is power and it's important to remember that communication is not lost on those who can't speak or those who can't hear; it is simply conveyed in other ways. Beautifully and compassionately.

When it came to "controlling" the conversation I would say I was in the drivers seat. I say this because he was looking to me to lead the way in how I wanted the conversation to go. Perhaps to make it easier. While we conversed about our days and the kids (we have 3 children, ages 10, 9 and 7) he would often say something, look to me and then confirm whether or not we were in agreement. We even let the kids in on the "game" and they had fun trying to do the same.  My daughter didn't like the fact that I wasn't speaking, so we cut it short after the 15 minute wrap up. Whenever I needed to get anyones attention I would simply tap them on the shoulder and then point to what I needed or wanted and then they would talk and confirm in reciprocity. It was a fun way for our family to connect, despite the hesitation on my daughters part. We each had own piece of the power because we all looked to each other to agree that we were on the same page and that our "voices" were being "heard".

The 2nd part of this experiment was much harder! It was hard enough trying not to change the intonation of my voice, let alone keeping my hands, facial expressions and body language at bay.  Thirty-nine percent of our language is expressed in our vocal intonation so taking that away, along with any kind of body language or gestures was difficult and comical, to say the least. Imagine if someone says to you, along the lines of this experiment, "you're wearing that". Without the intonation in my voice you don't know if I mean that to be a good thing or bad. We talked about our friends and potential plans for the weekend and while the conversation flowed freely my husband often found that he himself changed his intonation to match mine. Almost as if it was instinct to mirror my way of communicating.

I previously touched on this earlier in this post, but I will go more into detail here. Our use of "signs" and "non-speech language techniques" is crucial as language is more than just words. Way more. The very definition of language is, "a "system of relatively arbitrary symbols and grammatical signals that change across time and that members of a community share and use for several purposes; to interact with each other, to communicate their ideas, emotions, and intentions and to transmit their culture from generation to generation" ~Cokely & Baker-Shenk.  Of all traits of language, body language is MOST important, so taking that away, along with any intonation is a hinderance to conversing. I was able to express my words and say whatever I needed to; however, it took more work and time to also express any meaning behind what I was saying. 

Being able to read somebody's body language is crucial to playing a role in a conversation. Mis-reading body language could be detrimental, but it is up to the sender to decode a conversation prior to sending it and for the receiver to encode, (figure out) what was sent. Learning to better read body language can lead to a more successful way of life. Negotiations, business deals, sales pitches, parenting, teaching, leading in any way. The ability to accurately read someone is an important element in our lives.

Of course there are people who have difficult reading body language. Those with neurological disorders (e.g. autism) might have trouble reading body language. There are ways around concerns such as these that, kind of like the experiments above, would just take a little extra work and patience. Communication would exist in other manners. It might also be difficult to read body language for those within different cultures or societies than our own. Not only could it be difficult to read, we could also be perceived as rude. Not being able to read someone's body language could be beneficial when speaking with a medical professional. If a Dr. had news to give and wanted to focus on the positive aspect of treatment it would be beneficial to not be able to read his or her body language if it was a more serious case. Focusing on the positives can be mentally healthier than focusing on the negatives.

Piltdown Hoax Blog Post

The Piltdown Hoax was an impactful, game changing 40-year hoax that took place in the small village of Piltdown, East Sussex (England) in 1912.

It all started when an amateur archeologist named Charles Dawson claimed to have found a piece of an ancient human skull while digging through a gravel pit in Piltdown.  Upon this discovery he invited both England's leading geologist, Arthur Smith Woodward, (of the Natural History Museum) and French Paleontologist Father Pierre Teilhard de Chardin to join him in Piltdown. Prior to this point there been only been remains of primitive humans found in France, Germany and Asia so the discovery of evidence of the existence of primitive humans in England could finally put them on the map, so to speak. Knowing the potential of such a find, the three of them set forth on their archeological hunt and it was Charles Dawson who came up with the elusive find; a jawbone that was thought to belong the skull that was previously found. These findings were presented to the Royal Geological Society by Woodward in December 1912 and officially leveled the playing field of the existence of ancient human remains.  These findings were backed by reputable scientists, including Woodward so even though there may have been some skepticism, nobody was going to challenge them publicly.  It wasn't until 40 years later that these findings would be exposed for the frauds they were.

As the years went by and new dating methods emerged, the Piltdown Man was once again studied in 1949 by Professor Kenneth Oakley, (British Museums). Professor Oakley used the relative dating method, Flourine analysis, to determine that the human skull was significantly older than the jaw bone that Dawson had discovered in the same area. Flourine analysis is a method that only applies to bones that have been exposed to flourine, most likely through the seepage of groundwater. The longer the bones lie in the earth, the more flourine is incorporated during the fossilization process and bones that have been in the same place for the same duration should contain the same amount of flourine.  Oakley's discovery that the jaw bone was much younger than the skull was a surprising find that didn't make any sense.  It was this discovery that led scientists to conduct further testing and in 1953 scientists launched the first full scale analysis with better dating methods. It was immediately found that the bones had been stained, altered and forged. The teeth of the jaw had been filed down to look like those of a human and the bone was cut to fit the human skull. The jaw dated back less than 100 years and in fact belonged to a female orangutan. Scientists were blown away by these findings as it was hard to believe that anyone would be capable of making such a mockery of such a monumental scientific find. 

I have always believed that while science itself is backed by scientific methods, behind every scientist is a human being. And fault lies within all of us. Perhaps Charles Dawson was driven by his desire be apart of the Royal Society by being the one to find the existence of ancient humans in England or perhaps he, himself had been duped as well.  It's almost as if there was a wide spread conspiracy to keep the truth under lock and key as over the years following the discovery (and prior to the actual proof of fraud) there was very little, if any, access to the fossils for further studies.  If this hoax has taught us anything it's that scientists don't always act on their motives to test the validity of hypothesis, opinions can play a negative role in science and scientists are in fact capable of deceit.

I think the quote, "good science depends on objectivity" is incredibly important and a reason why we cannot remove the "human" factor from science to reduce the chance of errors like this from happening again. Not all scientists are frauds and not all findings are forged. Objectivity plays a vital role in science, and in the beginning if only one scientist had spoken up against the supposed human jaw bone than perhaps scientists could have been saved from 40 years of deception.  I absolutely do not want to remove the human factor as I find it the most interesting factor of science. I seek to challenge those who present scientific theories and in those challenges we learn new things.

My lesson in life that I take from this historical event is that just because someone says something is "science based" does not mean I cannot challenge it and provide evidence to the contrary. Taking information at face value from unverified sources would be MY mistake and not the fault of the person presenting the information. I am capable of doing research and then making informed decisions based on those findings.

Analogy/Homology Blog Post

For your homologous traits provide the following information:

a. Briefly describe (not just identify) the two different species that possess the homologous trait. 
-The two species that possess the homologous trait are: The giraffe and a human; while they both contain several similar structures, I am going to focus on the fact that, like other mammals, they both have seven cervical vertebrae.

b. Describe the homologous trait of each species, focusing on the differences in structure and function of the trait. Why do these homologous traits exhibit differences between the two species? Make sure your explanation is clear and complete. 
-While both humans and giraffes have seven cervical vertebrae with a nuchal ligament and both species use their necks to move their heads as needed, the giraffe's bones are significantly longer, (approx 1 ft long) and are bound together with ball-and-sock joints, thus giving them more flexibility. Male giraffes also use their necks during mating season to so called "go neck to neck" for females.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait? 
-Both giraffes and humans are placental mammals and and their common ancestor (for all placental mammals) is what is referred to as a tiny, furry-tailed creature that evolved after dinosaurs. Also described as a tree climbing, insect eating mammals.

d. Provide an image of each species in this comparison. 
-

For your analogous traits provide the following information:

a. Briefly describe the two different species that possess the analogous trait.
-Two species that possess the analogous trait are snakes of North America (e.g. rattle snake) and snakes in Australia (death adder). Snakes on both continents are ambush predators, stout bodied and have the ability to camouflage themselves; however they are dramatically different in diet.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. 
-The physical similarities of those snakes are thought to be due to evolutionary advantages.  Snakes on both continents are slender, fast moving, burrowing snakes with similar body forms and yet they evolved independently of each other in response to convergence.  Their similar body types evolved to help improve capturing prey. These snakes are dramatically different in what they eat. (e.g. most small snakes in North America eat invertebrates such as spiders, scorpions, slugs and centipedes and in Australia, those snakes tend to eat lizards and other snakes.)

c. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent?
North America is home to several groups of snakes, however only the elapids colonized in Australia approximately 12 million years ago. Elapids have hollow and fixed fangs that allow injecting venom and are now found worldwide (e.g. king cobras, coral snakes, mambas and kraits).  Evolution played a role over a million years ago for Australia's elapids to diversify and specialize through adaptive radiation.  Over time, these Australian snakes took on most of the body forms of those found in North America.

d. Provide an image of each species in this comparison.

death adder

rattle snake

Week 2 – Protein Synthesis: Blog Post

Here is my DNA Strand: (Enjoy!)

CGGCTACACCTAGTGGGATCTAAGTCTGAATACTCCGAACGTCTCCATCGTTA

Historical Influences on Darwin

I think it is safe to say that most everyone has heard the name Charles Darwin and his theory that goes along with his name; the theory of evolution by natural selection. What some of you may not know is that he was heavily inspired by the works of an English economist by the name of Thomas Malthus.

Malthus had written a book titled, "An Essay on the Principle of Population" which held the belief that growing populations would defeat resources needed for survival.  This theory led him to advocate for limiting resources by arguing that if resources were limited than that would help to impede population growth.  As you can see in the following article https://www.allaboutscience.org/thomas-malthus-faq.htm, Malthus was very clear in his intentions and believed in God's had a plan to "stop populations from exploding" and that without limiting our resources, our world would "quickly become overcrowded".

While Malthus argued that populations would defeat the amount of resources needed for survival, Darwin saw this as a means to further his theory of evolution by expanding upon those ideals and stating that population growth and limiting of resources could lead to competition, (those who were more equipped to withstand limitations would survive), which was the essence of natural selection. Who gets better access to these limited resources? Only the strong survive. By Malthus's focusing limiting resources, he inadvertently inspired Darwin and even though Malthus did not seek to become such an inspiration, (as he was not interested in how species were evolving and changing), his writings provided a way for Darwin to "refine" the idea of natural selection.

I believe that there is a chance that Darwin could have developed his theory of natural selection without the help of Malthus' book; however, I do not believe it would the theory we have come to know today. Natural selection means what it does today because of Darwin's introduction to Malthus' writings, specifically that "population size is always limited by the amount of available food and water" and that being the cause for a constant struggle to exist. Darwin himself attributes his development of natural selection to his findings in Malthus' essay and stated the following, "it at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The result of this would be the formation of a new species" (F. Darwin, 1950, pp 53-54).

In order for Darwin to make his findings public it would've meant he was directly challenging the christian belief that that "all life on earth was created by God", which would have most likely meant a certain death by fire. It wasn't until new world discoveries were being made and mathematicians and scientists made advances that helped to pave the way to introducing new theories.

If you were stranded on a desert island what two items you would take with you and why?

My list of necessities to be stranded on a desert island with would include a machete, alcohol, matches, a tent for shelter, sunscreen, bananas and peanut butter and a water filter/purifier.  If I had to choose only two of the aforementioned items to be stranded with, than I would choose a water filter/purifier and a machete.

I would choose the water filter to ensure safe hydration and the machete to cut down food growing on trees, to cut down vines, wood and leaves to build a shelter and raft to sail off the island and lastly to help create a spark to build a fire to keep warm and keep any potential predators away.  In addition to the water filter/purifier keeping me safely hydrated while stranded, it would continue to do so while heading back to civilization on my makeshift raft.